
IthaID: 2496
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | TTS +48 G>A | HGVS Name: | HBB:c.*182G>A |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: | CAP +1656 G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTTACTAAAAAGGGAATGTG [G/A] GAGGTCAGTGCATTTAAAACA (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72200 |
Size: | 1 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
Ethnic Origin: | Italian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Vinciguerra M, Passarello C, Leto F, Cassarà F, Cannata M, Maggio A, Giambona A, Identification of three new nucleotide substitutions in the β-globin gene: laboratoristic approach and impact on genetic counselling for beta-thalassaemia., Eur. J. Haematol. , 92(5), 444-9, 2014
Created on 2014-06-05 09:23:45,
Last reviewed on 2022-10-21 09:38:43 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.