IthaID: 2492

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: CD 12 ACT>CCT [Thr>Pro] HGVS Name: HBB:c.37A>C
Hb Name: Hb Ashburton Protein Info: β 12(A9) Thr>Pro
Also known as: Hb Feilding

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GACTCCTGAGGAGAAGTCTGCCGTT [A/C] CTGCCCTGTGGGGCAAGGTGAACGT (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70631
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: N/A
Molecular mechanism: Altered secondary structure
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Brennan SO, Povall A, Lankes U, Hb Ashburton [β12(A9)Thr → Pro; HBB: c.37A > C], a novel, mildly unstable variant and the first substitution identified at codon 12., Hemoglobin , 38(2), 79-83, 2014
  2. Ghallyan N, Donald T, Broad D, Johnson S, Browett P, Van de Water N, Hb Feilding [β12(A9)Thr → Pro; HBB: c.37A>C]: a novel unstable β-globin chain variant., Hemoglobin , 39(1), 49-51, 2015
Created on 2014-06-04 17:16:10, Last reviewed on 2017-01-17 10:45:54 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.