
IthaID: 248
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 125 (+CCA) | HGVS Name: | HBB:c.376_378dupCCA |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTGGCAAAGAATTCACCCCACCA [-/CCA] GTGCAGGCTGCCTATCAGAAAGT (Strand: -)
Comments: Found in a heterozygous state in a young Armenian girl with a dominant type of beta-thal trait, characterized by a rather severe anemia (Hb 7-9 g/dl), hypochromia, target cells, basophilic stippling, and splenomegaly. Parents were unavailable for study.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | Dominant |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71950 |
Size: | 3 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Armenian |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Cürük MA, Molchanova TP, Postnikov YuV , Pobedimskaya DD, Liang R, Baysal E, Kolodey S, Smetanina NS, Tokarev YuN , Rumyantsev AG, Beta-thalassemia alleles and unstable hemoglobin types among Russian pediatric patients., American journal of hematology, 46(4), 329-32, 1994
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-12 14:28:03 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.