IthaID: 248

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 125 (+CCA)	HGVS Name:	HBB:c.376_378dupCCA
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
TTGGCAAAGAATTCACCCCACCA [-/CCA] GTGCAGGCTGCCTATCAGAAAGT (Strand: -)

Also known as:

Comments: Found in a heterozygous state in a young Armenian girl with a dominant type of beta-thal trait, characterized by a rather severe anemia (Hb 7-9 g/dl), hypochromia, target cells, basophilic stippling, and splenomegaly. Parents were unavailable for study.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

LOVD

Phenotype

Hemoglobinopathy Group:	Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-thalassaemia, β-chain variant
Allele Phenotype:	Dominant
Stability:	N/A
Oxygen Affinity:	N/A
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	71950
Size:	3 bp
Located at:	β
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Insertion)
Effect on Gene/Protein Function:	Insertion/Deletion of codons (Protein Structure)
Ethnic Origin:	Armenian
Molecular mechanism:	N/A
Inheritance:	Dominant
DNA Sequence Determined:	No

In silico pathogenicity prediction

Publications / Origin

Cürük MA, Molchanova TP, Postnikov YuV , Pobedimskaya DD, Liang R, Baysal E, Kolodey S, Smetanina NS, Tokarev YuN , Rumyantsev AG, Beta-thalassemia alleles and unstable hemoglobin types among Russian pediatric patients., American journal of hematology, 46(4), 329-32, 1994

Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 14:28:03 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2019-11-12 14:22:19	The IthaGenes Curation Team	Reviewed. Mutation names and Location corrected. Allele, Context sequence and Comment added.
4	2019-11-12 14:23:12	The IthaGenes Curation Team	Reviewed.
5	2019-11-12 14:28:03	The IthaGenes Curation Team	Reviewed. Common name changed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.