IthaID: 2465

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 19 GCG>GC-	HGVS Name:	HBA2:c.60delG
Hb Name:	N/A	Protein Info:	p.His21Thrfs*29

Context nucleotide sequence:
GGCCGCCTGGGGTAAGGTCGGCGC [-/G] CACGCTGGCGAGTATGGTGCGGAG (Strand: +)

Also known as:

Comments: Detected as a homozygote and heterozygote in Iranian subjects with elevated Hb Bart's levels. The deletion of nt 'G' in codon 19 (GCG) creates a frameshift leading to a premature stop codon at codon 48 (TGA).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	ClinVar
dbSNP

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	33835
Size:	1 bp
Located at:	α2
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Iranian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

Harteveld CL, Yavarian M, Zorai A, Quakkelaar ED, van Delft P, Giordano PC, Molecular spectrum of alpha-thalassemia in the Iranian population of Hormozgan: three novel point mutation defects., American journal of hematology, 74(2), 99-103, 2003

Created on 2014-06-03 15:45:02, Last reviewed on 2022-11-21 13:28:49 (Show full history)

A/A	Date	Curator(s)	Comments
1	2014-06-03 15:45:02	The IthaGenes Curation Team	Created
2	2019-05-29 16:31:21	The IthaGenes Curation Team	Reviewed. Reference, Ethnic origin and Comment added.
3	2019-05-29 16:46:40	The IthaGenes Curation Team	Reviewed. Comment edited.
4	2020-04-21 19:44:50	The IthaGenes Curation Team	Reviewed. Allele and Context sequence added. dbSNP link added. Protein name corrected. Ethnic origin edited.
5	2020-04-21 19:45:24	The IthaGenes Curation Team	Reviewed.
6	2022-11-21 13:28:49	The IthaGenes Curation Team	Reviewed. Link added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.