
IthaID: 2463
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | TTS +99 C>C | HGVS Name: | HBB:c.*233G>C |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGAAGAGCTAGTTCAAACCTT [C/G] GGAAAATACACTATATCTTAAA (Strand: -)
Comments: This variant was described in a cohort of Palestinians with β-thal trait or disease as a possible β+ allele [PMID: 23321370]. Nevertheless, a subsequent study investigating 18 individuals with the HBB:c.*233G>C variant gave no evidence for pathogenicity, strongly suggesting that it is not associated with a β-thal phenotype [PMID: 26524961].
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72251 |
Size: | 1 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
Ethnic Origin: | Palestinian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Sirdah MM, Sievertsen J, Al-Yazji MS, Tarazi IS, Al-Haddad RM, Horstmann RD, Timmann C, The spectrum of β-thalassemia mutations in Gaza Strip, Palestine., Blood Cells Mol. Dis. , 50(4), 247-51, 2013
- Smith DL, Mitui M, Park JY, Luu HS, Timmons CF, Characterization of the HBB: c.*233G > C Variant: No Evidence of a β-Thalassemic Phenotype., Hemoglobin , 40(1), 25-8, 2016
Created on 2014-06-03 15:35:00,
Last reviewed on 2021-02-12 15:25:04 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.