IthaID: 245

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 123 (-A) >156aa HGVS Name: HBB:c.370delA
Hb Name: Hb Makabe Protein Info: β 123 (-A); modified C-terminal sequence: (123)Pro-His-Gln-Cys-Arg-Leu-Pro-Ile-Arg-Lys- Trp-Trp-Leu-Val-Trp-Leu-Met-Pro-Trp-Pro- Thr-Ser-Ile-Thr-Lys-Leu-Ala-Phe-Leu-Leu- Ser-Asn-Phe-(156)Tyr-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGCCCATCACTTTGGCAAAGAATTC [A/-] CCCCACCAGTGCAGGCTGCCTATCA (Strand: -)

Comments: Includion body β-thalassemia in the heterozygote. Unstable Hb variant.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71944
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Japanese
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Fucharoen S, Fucharoen G, Fukumaki Y, Nakayama Y, Hattori Y, Yamamoto K, Ohba Y, Three-base deletion in exon 3 of the beta-globin gene produced a novel variant (beta gunma) with a thalassemia-like phenotype., Blood, 76(9), 1894-6, 1990
  2. Fucharoen S, Kobayashi Y, Fucharoen G, Ohba Y, Miyazono K, Fukumaki Y, Takaku F, A single nucleotide deletion in codon 123 of the beta-globin gene causes an inclusion body beta-thalassaemia trait: a novel elongated globin chain beta Makabe., British journal of haematology, 75(3), 393-9, 1990
Created on 2010-06-16 16:13:15, Last reviewed on 2023-08-09 10:36:57 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.