IthaID: 245
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 123 (-A) >156aa | HGVS Name: | HBB:c.370delA |
| Hb Name: | Hb Makabe | Protein Info: | β 123 (-A); modified C-terminal sequence: (123)Pro-His-Gln-Cys-Arg-Leu-Pro-Ile-Arg-Lys- Trp-Trp-Leu-Val-Trp-Leu-Met-Pro-Trp-Pro- Thr-Ser-Ile-Thr-Lys-Leu-Ala-Phe-Leu-Leu- Ser-Asn-Phe-(156)Tyr-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGCCCATCACTTTGGCAAAGAATTC [A/-] CCCCACCAGTGCAGGCTGCCTATCA (Strand: -)
Comments: Includion body β-thalassemia in the heterozygote. Unstable Hb variant.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Thalassaemia dominant Dominant |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71944 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Japanese |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Fucharoen S, Fucharoen G, Fukumaki Y, Nakayama Y, Hattori Y, Yamamoto K, Ohba Y, Three-base deletion in exon 3 of the beta-globin gene produced a novel variant (beta gunma) with a thalassemia-like phenotype., Blood, 76(9), 1894-6, 1990
- Fucharoen S, Kobayashi Y, Fucharoen G, Ohba Y, Miyazono K, Fukumaki Y, Takaku F, A single nucleotide deletion in codon 123 of the beta-globin gene causes an inclusion body beta-thalassaemia trait: a novel elongated globin chain beta Makabe., British journal of haematology, 75(3), 393-9, 1990
Created on 2010-06-16 16:13:15,
Last reviewed on 2023-08-09 10:36:57 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.