
IthaID: 2433
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 13-14 -GCCTGG [-Ala-Trp] | HGVS Name: | HBA2:c.40_45delGCCTGG |
| Hb Name: | Hb Souli | Protein Info: | α2 13(A11) - 14(A12) Ala-Trp->0 |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGCCGACAAGACCAACGTCAAGGCC [GCCTGG/-] GGTAAGGTCGGCGCGCACGCTGGCG (Strand: +)
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33815 |
| Size: | 6 bp |
| Located at: | α2 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Kattamis A, Delaporta P, Fylaktou I, Vrettou C, Kyriakopoulou D, Stamoulakatou A, Papassotiriou I, Kanavakis E, Traeger-Synodinos J, Hb Souli, a 6 bp In-Frame Deletion on the HBA2 Gene (HBA2: c.[41-46delCCTGGG]) Leads to α-Thalassemia Intermedia, When in Trans to a Single α-Globin Gene Deletion., Hemoglobin , 2014
Created on 2014-05-30 10:54:56,
Last reviewed on 2015-01-13 16:25:31 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.