IthaID: 2433

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 13-14 -GCCTGG [-Ala-Trp] HGVS Name: HBA2:c.40_45delGCCTGG
Hb Name: Hb Souli Protein Info: α2 13(A11) - 14(A12) Ala-Trp->0
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGCCGACAAGACCAACGTCAAGGCC [GCCTGG/-] GGTAAGGTCGGCGCGCACGCTGGCG (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33815
Size: 6 bp
Located at: α2
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Kattamis A, Delaporta P, Fylaktou I, Vrettou C, Kyriakopoulou D, Stamoulakatou A, Papassotiriou I, Kanavakis E, Traeger-Synodinos J, Hb Souli, a 6 bp In-Frame Deletion on the HBA2 Gene (HBA2: c.[41-46delCCTGGG]) Leads to α-Thalassemia Intermedia, When in Trans to a Single α-Globin Gene Deletion., Hemoglobin , 2014
Created on 2014-05-30 10:54:56, Last reviewed on 2015-01-13 16:25:31 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.