IthaID: 243


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 120/121 (+A) HGVS Name: HBB:c.363dupA
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGTGCTGGCCCATCACTTTGGCAAA [-/A] GAATTCACCCCACCAGTGCAGGCTG (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71937
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Filipino
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Hopmeier P, Krugluger W, Gu LH, Smetanina NS, Huisman TH, A newly discovered frameshift at codons 120-121 (+A) of the beta gene is not associated with a dominant form of beta-thalassemia., Blood, 87(12), 5393-4, 1996
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 16:28:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.