IthaID: 242

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 120 -A [156 aa] HGVS Name: HBB:c.363delA
Hb Name: Hb Filottrano Protein Info: β 120 (-A); modified C-terminal sequence
Also known as: CD 120 AAA>AA-

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCTGGCCCATCACTTTGGCAA [-/A] GAATTCACCCCACCAGTG (Strand: -)

Comments: Single nucleotide deletion (-A) resulting in a frameshift and the elongation of the β-globin chain to 156 amino acids. Found as a compound heterozygote with Hb C in a patient of undisclosed ethnicity, presenting with severe anaemia. Also found in a heterozygous state in an Italian proband presenting with a β-thalassaemia intermedia phenotype. Reported in literature as HBB:c.361delA, which does not follow the HGVS Sequence Variant Nomeclature recommendations.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71937
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Frischknecht H, Dutly F, Walker L, Nakamura-Garrett LM, Eng B, Waye JS, Three new beta-thalassemia mutations with varying degrees of severity., Hemoglobin, 33(3), 220-5, 2009
  2. Amato A, Cappabianca MP, Perri M, Zaghis I, Mastropietro F, Ponzini D, Di Biagio P, Piscitelli R, Hb Filottrano [codon 120 (-A)]: a novel frameshift mutation in exon 3 of the β-globin gene causing dominantly inherited β-thalassemia intermedia., Hemoglobin , 36(5), 480-4, 2012
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-06 11:56:50 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.