IthaID: 241


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 118 (-T) > 156aa HGVS Name: HBB:c.357delT
Hb Name: Hb Sainte Seve Protein Info: β 118 (-T); modified C-terminal sequence: (118)Leu-Ala-Lys-Asn-Ser-Pro-His-Gln-Cys-Arg- Leu-Pro-Ile-Arg-Lys-Trp-Trp-Leu-Val-Trp- Leu-Met-Pro-Trp-Pro-Thr-Ser-Ile-Thr-Lys- Leu-Ala-Phe-Leu-Leu-Ser-Asn-Phe-(156)Tyr-COOH

Context nucleotide sequence:
GCTGGTCTGTGTGCTGGCCCATCACTT [-/T] GGCAAAGAATTCACCCCACCAGT (Strand: -)

Also known as:

Comments: Found in a heterozygous state in two members of a French family presenting with a chronic haemolytic anaemia.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71931
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: French
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

Publications / Origin

  1. Préhu C, Pissard S, Al-Sheikh M, Le Niger C, Bachir D, Galactéros F, Wajcman H, Two French Caucasian families with dominant thalassemia-like phenotypes due to hyper unstable hemoglobin variants: Hb Sainte Seve [codon 118 (-T)] and codon 127 [CAG-->TAG (Gln-->stop])., Hemoglobin, 29(3), 229-33, 2005
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-11 16:17:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.