IthaID: 241
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 118 (-T) > 156aa | HGVS Name: | HBB:c.357delT |
| Hb Name: | Hb Sainte Seve | Protein Info: | β 118 (-T); modified C-terminal sequence: (118)Leu-Ala-Lys-Asn-Ser-Pro-His-Gln-Cys-Arg- Leu-Pro-Ile-Arg-Lys-Trp-Trp-Leu-Val-Trp- Leu-Met-Pro-Trp-Pro-Thr-Ser-Ile-Thr-Lys- Leu-Ala-Phe-Leu-Leu-Ser-Asn-Phe-(156)Tyr-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCTGGTCTGTGTGCTGGCCCATCACTT [-/T] GGCAAAGAATTCACCCCACCAGT (Strand: -)
Comments: Found in a heterozygous state in two members of a French family presenting with a chronic haemolytic anaemia.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Thalassaemia dominant Dominant |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71931 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | French |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Préhu C, Pissard S, Al-Sheikh M, Le Niger C, Bachir D, Galactéros F, Wajcman H, Two French Caucasian families with dominant thalassemia-like phenotypes due to hyper unstable hemoglobin variants: Hb Sainte Seve [codon 118 (-T)] and codon 127 [CAG-->TAG (Gln-->stop])., Hemoglobin, 29(3), 229-33, 2005
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-11 16:17:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.