IthaID: 2407
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 49-55 (-19 bp +4 bp) | HGVS Name: | HBB:c.149_167delinsAGCT |
| Hb Name: | Hb Martinez | Protein Info: | β 49 - 55 (-TCCACTCCTGATGCTGTTA); modified C-terminal sequence AND β 49(+AGCT); modified C-terminal sequence |
Context nucleotide sequence:
GTTCTTTGAGTCCTTTGGGGATCTGT [AGCT/CCACTCCTGATGCTGTTAT] GGGCAACCCTAAGGTGAAGGCTCA (Strand: -)
Also known as:
Comments: Deletion of 19 nts (CCACTCCTGATGCTGTTAT) from codons 49-55 and insertion of nts AGCT. Reported in literature as HBB:c.148_166delinsAGCT, which does not follow the HGVS Sequence Variant Nomeclature recommendations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β+ Unclear |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70873 |
| Size: | 19 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | American-Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Created on 2014-05-28 09:24:50,
Last reviewed on 2019-11-11 16:47:15 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.