IthaID: 240
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 116 (+TGAT) | HGVS Name: | HBB:c.349_350insTGAT |
| Hb Name: | N/A | Protein Info: | β 116(+TGAT); modified C-terminal sequence: (116)Leu-Ile-Ser-Leu-Trp-Gln-Arg-Ile-His-Pro-Thr- Ser-Ala-Gly-Cys-Leu-Ser-Glu-Ser-Gly-Gly- Trp-Cys-Gly-(140)COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AACGTGCTGGTCTGTGTGCTGGCCC [-/TGAT] ATCACTTTGGCAAAGAATTCACCCC (Strand: -)
Comments: The insertion of TGAT within codon 116 (CAT>CTGATAT) generates a frameshift and a premature termination codon between codons 138 and 139. Found among members of a family who are Tamil refugees residing in Switzerland. Found in combination with HBB:c.364G>C (Hb D-Punjab) in a yound child presenting with microcytic anaemia. Found in a heterozygous state in the father.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71924 |
| Size: | 4 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Sri Lankan |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Frischknecht H, Kiewitz R, Schmugge M, A 4 base pair TGAT insertion at codon 116 of the beta globin gene causes beta0-thalassemia., Haematologica, 90(0), ECR20, 2005
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-14 09:15:02 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.