IthaID: 2392


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 143 CAC>TAC [His>Tyr] HGVS Name: HBD:c.430C>T
Hb Name: Hb Noah Mehmet Oeztuerk Protein Info: δ 143(H21) His>Tyr

Context nucleotide sequence:
GGCTGGTGTGGCTAATGCCCTGGCT [C/T] ACAAGTACCATTGAGATCCTGGACT (Strand: -)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 64638
Size: 1 bp
Located at: δ
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

  1. Bissé E, Schaeffer C, Hovasse A, Preisler-Adams S, Epting T, Baumstark M, Van Dorsselaer A, Horst J, Wieland H, Haemoglobin Noah Mehmet Oeztuerk (alpha(2) delta(2)143 (H21)His-->Tyr: A novel delta-chain variant in the 2,3-DPG binding site., J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. , 871(1), 55-9, 2008
Created on 2014-05-26 16:57:45, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.