IthaID: 2381


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Benign / Likely Benign
Common Name: CD 32 ATG>AAG [Met>Lys] HGVS Name: HBA1:c.98T>A
Hb Name: Hb Queens Park Protein Info: α1 32(B13) Met>Lys

Context nucleotide sequence:
CCTCACTCTGCTTCTCCCCGCAGGA [A/T] GTTCCTGTCCTTCCCCACCACCAAG (Strand: +)

Also known as: Hb Chao Pra Ya

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:α⁺
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37794
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Burmese, Thai
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Phylipsen M, Prior JF, Lim E, Lingam N, Finlayson J, Arkesteijn SG, Harteveld CL, Giordano PC, Two new alpha1-globin gene point mutations: Hb Nedlands (HBA1:c.86C>T) [alpha28(B9)Ala-->Val] and Hb Queens Park (HBA1:c.98T>A) [alpha32(B13)Met-->Lys]., Hemoglobin , 34(2), 123-6, 2010
  2. Viprakasit V, Ekwattanakit S, Chalaow N, Riolueang S, Wijit S, Tanyut P, Chat-Uthai N, Tachavanich K, Clinical presentation and molecular identification of four uncommon alpha globin variants in Thailand. Initiation codon mutation of α2-globin Gene (HBA2:c.1delA), donor splice site mutation of α1-globin gene (IVSI-1, HBA1:c.95 + 1G>A), hemoglobin Queens Park/Chao Pra Ya (HBA1:c.98T>A) and hemoglobin Westmead (HBA2:c.369C>G)., Acta Haematol. , 131(2), 88-94, 2014
Created on 2014-05-26 10:39:21, Last reviewed on 2022-07-12 13:27:48 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.