IthaID: 2362


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: CD 63 GCC>GTC [Ala>Val] HGVS Name: HBA2:c.191C>T
Hb Name: Hb Nakhon Ratchsima Protein Info: α2 63(E12) Ala>Val

Context nucleotide sequence:
GTTAAGGGCCACGGCAAGAAGGTGG [A/C/T] CGACGCGCTGACCAACGCCGTGGCG (Strand: +)

Also known as: Hb Aberystwyth

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34083
Size: 1 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Srivorakun H, Fucharoen G, Puangplruk R, Kheawon N, Fucharoen S, Complex interaction of hemoglobin (Hb) Nakhon Ratchasima [α63(E12)Ala→Val], a novel α2-globin chain variant with Hb E [β26(B8)Glu→Lys] and a deletional α(+)-thalassemia., Eur. J. Haematol. , 87(1), 68-72, 2011
Created on 2014-05-23 14:25:46, Last reviewed on 2014-06-02 10:09:44 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.