IthaID: 2346
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -154 C>T | HGVS Name: | NG_013087.1:g.4910C>T |
Context nucleotide sequence:
GAAGTTTGTGCCCCAGAAACAGTGC [C/T] CCCCCGCCGCCTTGCCTTGCTTTGC (Strand: -)
Also known as:
Comments: Found as a compound heterozygote with p.A298P in a Thai patient with severe, transfusion-dependent hemolytic anemia characterized by abnormally low levels of the red cell enzyme pyruvate kinase, a known cause of chronic nonspherocytic hemolytic anemias (CNSHA). Persistent expression of fetal haemoglobin (Hb F) and expression of large quantities of embryonic globins in post-natal life. The change is predicted to alter the binding of transcription factors P53, Pax5 and ETF [PMID: 24443441]. Found as a compound heterozygote with p.Q217X in Thai patients homozygous or heterozygous for Hb E. Patients showed high levels of Hb F and lower MCV and MCH values compared to healthy controls [PMID: 27282573].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | Increased expression for ε Increased expression for Aγ or Gγ |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_013087.1 |
Locus Location: | 4910 |
Size: | 1 bp |
Located at: | KLF1 |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Thai |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Viprakasit V, Ekwattanakit S, Riolueang S, Chalaow N, Fisher C, Lower K, Kanno H, Tachavanich K, Bejrachandra S, Saipin J, Juntharaniyom M, Sanpakit K, Tanphaichitr VS, Songdej D, Babbs C, Gibbons RJ, Philipsen S, Higgs DR, Mutations in Kruppel-like factor 1 cause transfusion-dependent hemolytic anemia and persistence of embryonic globin gene expression., Blood , 2014
- Tepakhan W, Yamsri S, Sanchaisuriya K, Fucharoen G, Xu X, Fucharoen S, Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder., Blood Cells Mol. Dis. , 59(0), 85-91, 2016
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2014-03-20 15:21:05 | The IthaGenes Curation Team | Created |
2 | 2014-03-20 16:31:26 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-08-11 09:21:29 | The IthaGenes Curation Team | Reviewed. Update of mutation characterization and reference list. |
4 | 2019-05-07 13:23:10 | The IthaGenes Curation Team | Reviewed. Mutation comment added. |