IthaID: 2341
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 58 (CAG>TAG) | HGVS Name: | NG_013087.1:g.6146C>T |
Context nucleotide sequence:
GCCCCTCCACGTGAAGTCTGAGGAC [C/T] AGCCCGGGGAGGAAGAGGACGATGA (Strand: -)
Also known as:
Comments: Protein change: Q58X. Compound heterozygote with p.A298P. Abnormally low levels of the red cell enzyme pyruvate kinase, a known cause of CNSHA. Severe, transfusion dependent hemolytic anemia. Persistent expression of fetal hemoglobin and expression of large quantities of embryonic globins in post-natal life.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | Increased expression for ε |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_013087.1 |
Locus Location: | 6146 |
Size: | 1 bp |
Located at: | KLF1 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Thai |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Viprakasit V, Ekwattanakit S, Riolueang S, Chalaow N, Fisher C, Lower K, Kanno H, Tachavanich K, Bejrachandra S, Saipin J, Juntharaniyom M, Sanpakit K, Tanphaichitr VS, Songdej D, Babbs C, Gibbons RJ, Philipsen S, Higgs DR, Mutations in Kruppel-like factor 1 cause transfusion-dependent hemolytic anemia and persistence of embryonic globin gene expression., Blood , 2014
Created on 2014-02-26 19:19:20,
Last reviewed on 2014-03-20 10:47:23 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2014-02-26 19:19:20 | The IthaGenes Curation Team | Created |
2 | 2014-03-17 11:32:22 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-03-20 10:47:23 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07