
IthaID: 231
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 107 (+G) | HGVS Name: | HBB:c.323dupG |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTATCTTCCTCCCACAGCTCCTGG [-/G] CAACGTGCTGGTCTGTGTGCTGG (Strand: -)
Comments: The G duplication at codon 107, causes a frameshift with a terminating codon at codon 139.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71897 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | African-American, Egyptian, North African, Moroccan |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Wong C, Dowling CE, Saiki RK, Higuchi RG, Erlich HA, Kazazian HH, Characterization of beta-thalassaemia mutations using direct genomic sequencing of amplified single copy DNA., Nature, 330(6146), 384-6, 1987
- Hussein IR, Temtamy SA, el-Beshlawy A, Fearon C, Shalaby Z, Vassilopoulos G, Kazazian HH, Molecular characterization of beta-thalassemia in Egyptians., Human mutation, 2(1), 48-52, 1993
- Wong A, Alder V, Robertson D, Papadimitriou J, Maserei J, Berdoukas V, Kontoghiorghes G, Taylor E, Baker E, Liver iron depletion and toxicity of the iron chelator deferiprone (L1, CP20) in the guinea pig., Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine, 10(4), 247-56, 1997
Created on 2010-06-16 16:13:15,
Last reviewed on 2021-10-20 14:36:40 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.