IthaID: 2292


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 19 AAC>AAA [Asn>Lys] HGVS Name: HBD:c.60C>A
Hb Name: Hb Famagusta Protein Info: δ 19 Asn>Lys

Context nucleotide sequence:
ctgactcctgaggagaagactgctgtcaatgccctgtggggcaaagtgaa [C/A] gtggatgcagttggtggtgaggccctgggcagattactggtggtctaccc (Strand: -)

Also known as:

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-thalassaemia, δ-chain variant
Allele Phenotype:δ+
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63242
Size: 1 bp
Located at: δ
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Cypriot
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

  1. Lederer CW, Pavlou E, Makariou C, Hadjilambi G, Andreou N, Hadjigavriel M, Kolnagou A, Sitarou M, Christou S, Kleanthous M, Hb Famagusta-analysis of a novel δ-globin chain variant [HBD:c.60C>A] in four families with diverse globin genotypes., Ann. Hematol. , 2014
Created on 2013-11-19 17:08:06, Last reviewed on 2014-01-28 09:12:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.