IthaID: 2289


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: IVS I-146 (G>A) HGVS Name: NT_010393.16:g.31479430G>A

Context nucleotide sequence:
GGGGAGGAAGTGGGTTGGGGGAAATACCCAGTGAGGAGGGAAACAGATAT [G/A] TAAATTCTACCCTTTTCTCTACCCAGGCAGATGGCTCTTCTTAAGGCCAATAAGGATCTC (Strand: +)

Also known as: 12391 (G>A), c.100-27G, rs4296276

Comments: This SNP in intron 1 of AHSP affects the Oct-1 transcription factor binding site, which is required for optimal AHSP promoter activity. The A allele is predicted to impair Oct-1 binding and thus reduce ASHP mRNA expression. (PMID 16186125)

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):Decreased expression for AHSP
Allele Phenotype (Trans):N/A
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 16
Locus: NT_010393.16
Locus Location: 31479430
Size: 1 bp
Located at: AHSP
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Gallagher PG, Liem RI, Wong E, Weiss MJ, Bodine DM, GATA-1 and Oct-1 are required for expression of the human alpha-hemoglobin-stabilizing protein gene., J. Biol. Chem. , 280(47), 39016-23, 2005
Created on 2013-10-16 17:04:31, Last reviewed on 2019-07-04 12:01:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.