IthaID: 2288


Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: IVS I-103 (G>A) HGVS Name: NT_010393.16:g.31479386G>A

Context nucleotide sequence:
GTTTTGGAAAGGAGATAGCCCTGCAGGGCAGGAGGGATTTTTAAGGGGAG [G/A] AAGTGGGTTGGGGGAAATACCCAGTGAGGAGGGAAACAGATATGTAAATTCTACCCTTTT (Strand: +)

Also known as: 12347 (G>A), c.100-72G, rs8050390

Comments: Apparently neutral polymorphism in the promoter region of AHSP (alpha-haemoglobin stabilizing protein)

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NT_010393.16
Locus Location: 31479386
Size: 1 bp
Located at: AHSP
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. dos Santos CO, Zhou S, Secolin R, Wang X, Cunha AF, Higgs DR, Kwiatkowski JL, Thein SL, Gallagher PG, Costa FF, Weiss MJ, Population analysis of the alpha hemoglobin stabilizing protein (AHSP) gene identifies sequence variants that alter expression and function., Am. J. Hematol. , 83(2), 103-8, 2008
Created on 2013-10-16 16:31:05, Last reviewed on 2020-09-28 16:46:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.