IthaID: 2282
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 139/140 +T [163 aa] | HGVS Name: | HBB:c.420dupT |
| Hb Name: | Hb Boston-Kuwait | Protein Info: | N/A |
Context nucleotide sequence:
AAAGTGGTGGCTGGTGTGGCTAAT [-/T] GCCCTGGCCCACAAGTATCACTAA (Strand: -)
Also known as:
Comments: Found in a young patient with an transfusion-dependent thalassaemia major phenotype. Consanguineous Kuwaiti parents and seven older siblings were healthy.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Dominant |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71994 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Kuwaiti |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Croteau SE, Luo HY, Lehmann LE, Chui DH, Neufeld EJ, Novel dominant β-thalassemia: Hb Boston-Kuwait [codon 139/140(+T)]., Pediatr Blood Cancer , 60(10), E131-4, 2013
Created on 2013-10-09 13:14:07,
Last reviewed on 2019-11-13 15:25:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.