IthaID: 228

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-850 (-G) HGVS Name: HBB:c.316-1delG
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TCATACCTCTTATCTTCCTCCCACA [-/G] CTCCTGGGCAACGTGCTGGTCTGTG (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71889
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Splice junction (mRNA Processing)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Rosatelli MC, Tuveri T, Scalas MT, Leoni GB, Sardu R, Faà V, Meloni A, Pischedda MA, Demurtas M, Monni G, Molecular screening and fetal diagnosis of beta-thalassemia in the Italian population., Human genetics, 89(6), 585-9, 1992
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.