IthaID: 2277
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 332 (AAA>CAA) | HGVS Name: | NG_013087.1:g.7224A>C |
Context nucleotide sequence:
GGACGAGCTGACCCGCCACTACCGG [A/C] AACACACGGGGCAGCGCCCCTTCCG (Strand: -)
Also known as:
Comments: Protein change: K332Q. In a Sardinia family, high levels of HbF were present only in compound heterozygotes for the S270X nonsense and K332Q missense mutations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_013087.1 |
| Locus Location: | 7224 |
| Size: | 1 bp |
| Located at: | KLF1 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Sardinians |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Satta S, Perseu L, Moi P, Asunis I, Cabriolu A, Maccioni L, Demartis FR, Manunza L, Cao A, Galanello R, Compound heterozygosity for KLF1 mutations associated with remarkable increase of fetal hemoglobin and red cell protoporphyrin., Haematologica , 96(5), 767-70, 2011
Created on 2013-10-08 17:39:58,
Last reviewed on 2014-03-20 10:43:56 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.