IthaID: 2229
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs9376230 | HGVS Name: | NG_011965.1:g.16292G>T |
Context nucleotide sequence:
CTAACCATCATGCCCAGGAAACAGC [A/C] CAAGACTTGCCTGAAGAAAGCCCAA (Strand: +)
Also known as:
Comments: SNP associated with the HbF response to treatment with hydroxyurea in individuals with sickle cell disease (n=137) acquired from the Multicenter Study of Hydroxyurea in Sickle Cell Anemia (MSH). SNP associated with HbF response to hydroxyurea, as well as disease severity in Greek patients with HbS/β-thalassaemia.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F response to hydroxyurea |
Location
Chromosome: | 6 |
---|---|
Locus: | NG_011965.1 |
Locus Location: | 16292 |
Size: | 1 bp |
Located at: | MAP3K5 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American, Greek |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007
- Tafrali C, Paizi A, Borg J, Radmilovic M, Bartsakoulia M, Giannopoulou E, Giannakopoulou O, Stojiljkovic-Petrovic M, Zukic B, Poulas K, Stavrou EF, Lambropoulou P, Kourakli A, Felice AE, Papachatzopoulou A, Philipsen S, Pavlovic S, Georgitsi M, Patrinos GP, Genomic variation in the MAP3K5 gene is associated with β-thalassemia disease severity and hydroxyurea treatment efficacy., Pharmacogenomics , 14(5), 469-83, 2013
Created on 2013-10-02 17:34:51,
Last reviewed on 2016-10-14 14:02:43 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-10-02 17:34:51 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-05-12 17:37:02 | The IthaGenes Curation Team | Reviewed. |
4 | 2016-10-14 14:02:43 | The IthaGenes Curation Team | Reviewed. Mutation comment section updated. Origin and Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07