IthaID: 2228
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | 3'UTR +107 A>G | HGVS Name: | HBA2:c.*107A>G |
Hb Name: | N/A | Protein Info: | α2 nt 832 A>G |
Context nucleotide sequence:
GTCTTTGAATAAAGTCTGAGTGGGC [A/G] GCAGCCTGTGTGTGCCTGGGTTCTC (Strand: +)
Also known as: 3' UTR +832 G>A
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34570 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
Ethnic Origin: | Italian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- De Angioletti M, Lacerra G, Boletinio E, Di Noce F, Musollino G, Carestia C, Beta- and alpha-globin genotypes in Albanian patients affected by beta-globin gene disorders., Haematologica , 87(9), 1002-3, 2002
Created on 2013-10-02 17:30:26,
Last reviewed on 2024-09-10 10:53:47 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-10-02 17:30:26 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-06-05 08:56:49 | The IthaGenes Curation Team | Reviewed. Functionality corrected. |
4 | 2016-09-05 14:55:21 | The IthaGenes Curation Team | Reviewed. |
5 | 2022-05-16 10:06:11 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
6 | 2024-09-10 10:53:04 | The IthaGenes Curation Team | Reviewed. Functionality corrected. |
7 | 2024-09-10 10:53:47 | The IthaGenes Curation Team | Reviewed. Synonyms added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07