IthaID: 2227


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs9483947 HGVS Name: NG_011965.1:g.13257G>A

Context nucleotide sequence:
CAGAGCCGGTCATGACAACATGCAG [C/T] TGATGATGTGGGGTAAGAAATTGGT (Strand: +)

Also known as:

Comments: SNP associated with the HbF response to treatment with hydroxyurea in individuals with sickle cell disease (n=137) acquired from the Multicenter Study of Hydroxyurea in Sickle Cell Anemia (MSH). SNP associated with HbF response to hydroxyurea, as well as disease severity in Greek patients with HbS/β-thalassaemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 6
Locus: NG_011965.1
Locus Location: 13257
Size: 1 bp
Located at: MAP3K5
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Greek
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007
  2. Tafrali C, Paizi A, Borg J, Radmilovic M, Bartsakoulia M, Giannopoulou E, Giannakopoulou O, Stojiljkovic-Petrovic M, Zukic B, Poulas K, Stavrou EF, Lambropoulou P, Kourakli A, Felice AE, Papachatzopoulou A, Philipsen S, Pavlovic S, Georgitsi M, Patrinos GP, Genomic variation in the MAP3K5 gene is associated with β-thalassemia disease severity and hydroxyurea treatment efficacy., Pharmacogenomics , 14(5), 469-83, 2013
Created on 2013-10-02 17:29:56, Last reviewed on 2016-10-14 13:40:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.