IthaID: 2226


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: 3'UTR +46 C>A HGVS Name: HBA2:c.*46C>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TCCTGCCCGCTGGGCCTCCCAA [C/A] GGGCCCTCCTCCCCTCCTTGCA (Strand: +)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34509
Size: 1 bp
Located at: α2
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Publications / Origin

  1. Tamaddoni A, Hadavi V, Nejad NH, Khosh-Ain A, Siami R, Aghai-Meibodi J, Almadani N, Oberkanins C, Law HY, Najmabadi H, alpha-Thalassemia mutation analyses in Mazandaran province, North Iran., Hemoglobin , 33(2), 115-23, 2009
Created on 2013-10-02 17:10:42, Last reviewed on 2022-05-16 09:54:18 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.