IthaID: 22


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -30 (T>A) HGVS Name: HBB:c.-80T>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGAGGGCAGGAGCCAGGGCTGGGCA [A/C/G/T] AAAAGTCAGGGCAGAGCCATCTATT (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70515
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Mediterranean, Bulgarian
Molecular mechanism: TATAA box (HBB)
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Fei YJ, Stoming TA, Efremov GD, Efremov DG, Battacharia R, Gonzalez-Redondo JM, Altay C, Gurgey A, Huisman TH, Beta-thalassemia due to a T----A mutation within the ATA box., Biochemical and biophysical research communications, 153(2), 741-7, 1988
Created on 2010-06-16 16:13:14, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.