IthaID: 2198


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: Poly A (A>T) AATAAA>AATATA HGVS Name: HBB:c.*112A>T
Hb Name: N/A Protein Info: β nt 1586 A>T

Context nucleotide sequence:
TTGAGCATCTGGATTCTGCCTAATA [A/G/T] AAAACATTTATTTTCATTGCAATGA (Strand: -)

Also known as:

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72130
Size: 1 bp
Located at: β
Specific Location: Poly(A)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

  1. Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016
Created on 2013-09-30 17:46:45, Last reviewed on 2016-08-31 18:04:22 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.