IthaID: 2197


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 131 (+A) HGVS Name: HBB:c.395dupA
Hb Name: N/A Protein Info: β 131(+A); modified C-terminal sequence: (131)Gln-Glu-Ser-Gly-Gly-Trp-Cys-Gly-(139)COOH

Context nucleotide sequence:
ACCCCACCAGTGCAGGCTGCCTATC [-/A] AGAAAGTGGTGGCTGGTGTGGCTAA (Strand: -)

Also known as:

Comments: Found in a proband with a typical beta-thalassaemia trait phenotype.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71969
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: British
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

  1. Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016
Created on 2013-09-30 17:39:13, Last reviewed on 2019-11-12 11:13:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.