IthaID: 2191
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 107-111 (-12 bp): (-GCAACGTGCTGG) | HGVS Name: | HBB:c.323_334del |
| Hb Name: | N/A | Protein Info: | β 107(G9) - 110(G12) Gly-Asn-Val-Leu->0 |
Context nucleotide sequence:
TCTTATCTTCCTCCCACAGCTCCTGG [GCAACGTGCTGG/-] TCTGTGTGCTGGCCCATCACTTTGG (Strand: -)
Also known as:
Comments: Published as HBB:c.319_330delCTGGGCAACGTG, which does not follow the HGVS Sequence Variant Nomeclature recommendations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | Unclear |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71897 |
| Size: | 12 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Created on 2013-09-30 17:12:49,
Last reviewed on 2021-05-27 16:07:21 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.