IthaID: 2180

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 5/6 -TG	HGVS Name:	HBB:c.18_19delTG
Hb Name:	N/A	Protein Info:	β 5-6 (-TG); modified C-terminal sequence: (5)Pro-Gly-Glu-Val-Cys-Arg-Tyr-Cys-Pro-Val- Gly-Gln-Gly-Glu-Arg-Gly-(21)COOH

Context nucleotide sequence:
CAGACACCATGGTGCATCTGACTCC [-/TG] AGGAGAAGTCTGCCGTTACTGCCCT (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
LOVD	ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β0
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70612
Size:	2 bp
Located at:	β
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Turkish
Molecular mechanism:	Altered secondary structure
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016

Created on 2013-09-30 16:04:02, Last reviewed on 2016-08-31 16:59:29 (Show full history)

A/A	Date	Curator(s)	Comments
1	2013-09-30 16:04:02	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2014-04-17 09:34:02	The IthaGenes Curation Team	Reviewed. Added context sequence and changed HGVS name.
4	2016-08-31 16:59:29	The IthaGenes Curation Team	Reviewed. Reference added. Confirmed by sequencing.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.