IthaID: 2148


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2182008 HGVS Name: NG_012003.1:g.87205T>C

Context nucleotide sequence:
GGATGCTGGCAGAAAAAGGCGTAGC [A/G] TTGGAAGGAGTGTTTAGACAGAATG (Strand: +)

Also known as:

Comments: SNP associated with changes in HbF levels in sickle cell anaemia patients of African-American origin (MSH cohort) in response to hydroxyurea treatment [PMID: 17299377]. It also associated with elevated HbF levels among non transfusion-dependent β-thal (NTDT) patients of Hellenic (Greek) origin in two independent studies [PMID: 31039620]. In silico analysis showed that this intronic variant causes no significant splicing motif alteration.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea

Location

Chromosome: 13
Locus: NG_012003.1
Locus Location: 87205
Size: 1 bp
Located at: FLT1
Specific Location: Intron 10

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Greek
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007
  2. Kolliopoulou A, Siamoglou S, John A, Sgourou A, Kourakli A, Symeonidis A, Vlachaki E, Chalkia P, Theodoridou S, Ali BR, Katsila T, Patrinos GP, Papachatzopoulou A, Role of Genomic Biomarkers in Increasing Fetal Hemoglobin Levels Upon Hydroxyurea Therapy and in β-Thalassemia Intermedia: A Validation Cohort Study., Hemoglobin, 2019
Created on 2013-09-27 14:41:04, Last reviewed on 2019-05-28 12:18:10 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.