
IthaID: 2148
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2182008 | HGVS Name: | NG_012003.1:g.87205T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGATGCTGGCAGAAAAAGGCGTAGC [A/G] TTGGAAGGAGTGTTTAGACAGAATG (Strand: +)
Comments: SNP associated with changes in HbF levels in sickle cell anaemia patients of African-American origin (MSH cohort) in response to hydroxyurea treatment [PMID: 17299377]. It also associated with elevated HbF levels among non transfusion-dependent β-thal (NTDT) patients of Hellenic (Greek) origin in two independent studies [PMID: 31039620]. In silico analysis showed that this intronic variant causes no significant splicing motif alteration.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Hb F response to hydroxyurea |
Location
Chromosome: | 13 |
---|---|
Locus: | NG_012003.1 |
Locus Location: | 87205 |
Size: | 1 bp |
Located at: | FLT1 |
Specific Location: | Intron 10 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American, Greek |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007
- Kolliopoulou A, Siamoglou S, John A, Sgourou A, Kourakli A, Symeonidis A, Vlachaki E, Chalkia P, Theodoridou S, Ali BR, Katsila T, Patrinos GP, Papachatzopoulou A, Role of Genomic Biomarkers in Increasing Fetal Hemoglobin Levels Upon Hydroxyurea Therapy and in β-Thalassemia Intermedia: A Validation Cohort Study., Hemoglobin, 2019
Created on 2013-09-27 14:41:04,
Last reviewed on 2019-05-28 12:18:10 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.