IthaID: 2138
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS X-1549 A>G | HGVS Name: | NG_011994.1:g.333995G>A |
Context nucleotide sequence:
GGCATCTCAGATCCAGACCAGTGTGA [A/G] GCAAGTCAAGAAGGCCCTAATTTAG (Strand: +)
Also known as: rs487278
Comments: Associated with the HbF response to hydroxyurea (HU) in SCD patients
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F response to hydroxyurea |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NG_011994.1 |
| Locus Location: | 333995 |
| Size: | 1 bp |
| Located at: | PDE7B |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African Americans |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007
Created on 2013-09-27 09:57:39,
Last reviewed on 2013-10-15 17:00:14 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.