IthaID: 213
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS II-726 A>G | HGVS Name: | HBB:c.316-125A>G |
| Hb Name: | N/A | Protein Info: | β nt 1221 A>G |
Context nucleotide sequence:
CTGATGTAAGAGGTTTCATATTGCT [A/G] ATAGCAGCTACAATCCAGCTACCAT (Strand: -)
Also known as:
Comments: Found in a homozygous state in an 8-year-old Moroccan male with beta-thalassaemia intermedia. Mother was heterozygous for this variant with blood profiles consistent with β-thalassaemia trait [PMID: 17994377]. Detected as a heterozygote (normal or borderline red cell indices) and in association with β0 IVS I-1 G>A ( heterozygous trait phenotype) in the resident Sicilian population [PMID: 29171316]. Detected as a heterozygote in five individuals with normal hematology and in association with Hb D-Punjab without a thalassaemia phenotype [PMID: 30047296]. Reported as a mild β+ allele.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71765 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Moroccan, Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Agouti I, Bennani M, Ahmed A, Barakat A, Mohamed K, Badens C, Thalassemia intermedia due to a novel mutation in the second intervening sequence of the beta-globin gene., Hemoglobin, 31(4), 433-8, 2007
- Vinciguerra M, Cannata M, Cassarà F, Passarello C, Leto F, Calvaruso G, Renda D, Maggio A, Giambona A, HBB: c.316-125A>G and HBB: c.316-42delC: Phenotypic Evaluations of Two Rare Changes in the Second Intron of the HBB Gene., Hemoglobin, 41(0), 234-238, 2017
- Grimholt RM, Harteveld CL, Arkesteijn SGJ, Fjeld B, Klingenberg O, Characterization of Two Deep Intronic Variants on the β-Globin Gene with Inconsistent Interpretations of Clinical Significance., Hemoglobin, 42(2), 126-128, 2018