IthaID: 2129


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs708564 HGVS Name: NG_023386.1:g.16553C>T

Context nucleotide sequence:
AAGACTCGCCCAGGCCCATGGGAGT [C/T] GGATGGTGGCCGCACTTGTGGGGCC (Strand: +)

Also known as:

Comments: SNP associated with susceptibility to alloimmunization in individuals with sickle cell disease receiving red blood cell transfusions (n=75).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Red blood cell alloimmunisation

Location

Chromosome: 11
Locus: NG_023386.1
Locus Location: 16553
Size: 1 bp
Located at: CD81
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Sub-Saharan African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Tatari-Calderone Z, Tamouza R, Le Bouder GP, Dewan R, Luban NL, Lasserre J, Maury J, Lionnet F, Krishnamoorthy R, Girot R, Vukmanovic S, The association of CD81 polymorphisms with alloimmunization in sickle cell disease., Clin. Dev. Immunol. , 2013(65535), 937846, 2013
Created on 2013-09-24 13:13:45, Last reviewed on 2016-09-12 12:50:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.