
IthaID: 2129
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs708564 | HGVS Name: | NG_023386.1:g.16553C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGACTCGCCCAGGCCCATGGGAGT [C/T] GGATGGTGGCCGCACTTGTGGGGCC (Strand: +)
Comments: SNP associated with susceptibility to alloimmunization in individuals with sickle cell disease receiving red blood cell transfusions (n=75).
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Red blood cell alloimmunisation |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_023386.1 |
Locus Location: | 16553 |
Size: | 1 bp |
Located at: | CD81 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Sub-Saharan African |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Tatari-Calderone Z, Tamouza R, Le Bouder GP, Dewan R, Luban NL, Lasserre J, Maury J, Lionnet F, Krishnamoorthy R, Girot R, Vukmanovic S, The association of CD81 polymorphisms with alloimmunization in sickle cell disease., Clin. Dev. Immunol. , 2013(65535), 937846, 2013
Created on 2013-09-24 13:13:45,
Last reviewed on 2016-09-12 12:50:05 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.