IthaID: 2128
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs10128556 | HGVS Name: | NG_000007.3:g.55163G>A |
Context nucleotide sequence:
TCCTATCCTTCTCTTACTTGCTATG [C/T] CAACTCACTACCCCAACATATTGTG (Strand: +)
Also known as:
Comments: Variation associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1032). Reported weak association in individuals from Thailand with HbE/β0-thalassemia (mild disease group, n=207), and strong association with disease severity. Reported to influence HbF expression levels in Saudi patients with sickle cell disease (SCD). The C allele associated with HbF levels in Kuwaiti patients with SCD, specifically in patients with up to 30% HbF but not beyond. It also identifies the RFLP site HincII in the beta-globin gene cluster for the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Severity [HP:0012824] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 55163 |
Size: | 1 bp |
Located at: | pseudo β |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American, Thai, Saudi, Kuwaiti |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010
- Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
- Vathipadiekal V, Alsultan A, Baltrusaitis K, Farrell JJ, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Suliman A, Patra PK, Milton JN, Farrer LA, Chui DH, Al-Ali AK, Sebastiani P, Steinberg MH, Homozygosity for a haplotype in the HBG2-OR51B4 region is exclusive to Arab-Indian haplotype sickle cell anemia., Am. J. Hematol. , 91(6), E308-11, 2016
- Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017
- Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-09-24 12:47:20 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-23 18:53:43 | The IthaGenes Curation Team | Reviewed. Reference added. |
4 | 2016-05-16 17:15:44 | The IthaGenes Curation Team | Reviewed. |
5 | 2016-05-18 15:42:41 | The IthaGenes Curation Team | Reviewed. |
6 | 2016-05-25 10:07:25 | The IthaGenes Curation Team | Reviewed. |
7 | 2016-05-25 10:11:53 | The IthaGenes Curation Team | Reviewed. |
8 | 2016-08-10 09:18:10 | The IthaGenes Curation Team | Reviewed. Update of mutation characterization. |
9 | 2016-08-10 09:34:24 | The IthaGenes Curation Team | Reviewed. |
10 | 2020-04-22 13:48:23 | The IthaGenes Curation Team | Reviewed. Comment updated. Reference added. |
11 | 2021-07-09 14:10:10 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
12 | 2021-12-21 12:29:17 | The IthaGenes Curation Team | Reviewed. Reference added. Comment updated. |