IthaID: 2127


Names and Sequences

Functionality: Disease modifying mutation
Common Name: -158 C>T HGVS Name: NG_000007.3:g.42677C>T

Context nucleotide sequence:
CAACCCATGGGTGGAGTTTAGCCAGG [C/T] ACCGTTTCAGACAGATATTTGCATT (Strand: -)

Also known as: XmnI

Comments: Xmn1-Gγ site is common in all population groups and is present at a frequency of 0.32–0.35. Xmn1-Gγ does not always raise the Hb F levels in otherwise normal individuals. Under conditions of haemopoietic stress, for example in homozygous β-thalassaemia and sickle cell disease, presence of the Xmn1-Gγ site favour a higher Hb F response. The presence of the XmnI T/T genotype correlates strongly in response to hydroxyurea treatment in transfusion-dependent β-thal patients.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42677
Size: 1 bp
Located at:
Specific Location: Promoter

Phenotype

Allele Phenotype (Cis):Increased expression for Gγ
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

  1. Labie D, Pagnier J, Lapoumeroulie C, Rouabhi F, Dunda-Belkhodja O, Chardin P, Beldjord C, Wajcman H, Fabry ME, Nagel RL, Common haplotype dependency of high G gamma-globin gene expression and high Hb F levels in beta-thalassemia and sickle cell anemia patients., Proc. Natl. Acad. Sci. U.S.A. , 82(7), 2111-4, 1985
  2. Gilman JG, Huisman TH, DNA sequence variation associated with elevated fetal G gamma globin production., Blood , 66(4), 783-7, 1985
  3. Sampietro M, Thein SL, Contreras M, Pazmany L, Variation of HbF and F-cell number with the G-gamma Xmn I (C-T) polymorphism in normal individuals., Blood , 79(3), 832-3, 1992
  4. Yavarian M, Karimi M, Bakker E, Harteveld CL, Giordano PC, Response to hydroxyurea treatment in Iranian transfusion-dependent beta-thalassemia patients., Haematologica, 89(10), 1172-8, 2004
  5. Thein SL, Genetic insights into the clinical diversity of beta thalassaemia., Br. J. Haematol. , 124(3), 264-74, 2004
  6. Alebouyeh M, Moussavi F, Haddad-Deylami H, Vossough P, Hydroxyurea in the treatment of major beta-thalassemia and importance of genetic screening., Ann. Hematol. , 83(7), 430-3, 2004
  7. Bradai M, Pissard S, Abad MT, Dechartres A, Ribeil JA, Landais P, de Montalembert M, Decreased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major or intermedia., Transfusion , 47(10), 1830-6, 2007
  8. Koren A, Levin C, Dgany O, Kransnov T, Elhasid R, Zalman L, Palmor H, Tamary H, Response to hydroxyurea therapy in beta-thalassemia., Am. J. Hematol. , 83(5), 366-70, 2008
  9. Italia KY, Jijina FJ, Merchant R, Panjwani S, Nadkarni AH, Sawant PM, Nair SB, Ghosh K, Colah RB, Response to hydroxyurea in beta thalassemia major and intermedia: experience in western India., Clin. Chim. Acta , 407(1), 10-5, 2009
  10. Banan M, Bayat H, Azarkeivan A, Mohammadparast S, Kamali K, Farashi S, Bayat N, Khani MH, Neishabury M, Najmabadi H, The XmnI and BCL11A single nucleotide polymorphisms may help predict hydroxyurea response in Iranian β-thalassemia patients., Hemoglobin , 36(4), 371-80, 2012
Created on 2013-09-24 12:25:07, Last reviewed on 2016-10-25 11:28:40 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.