IthaID: 2127

Context nucleotide sequence:
CAACCCATGGGTGGAGTTTAGCCAGG [C/T] ACCGTTTCAGACAGATATTTGCATT (Strand: -)

Also known as: XmnI, rs7482144

Comments: Xmn1-Gγ site is common in all population groups and is present at a frequency of 0.32–0.35. Xmn1-Gγ does not always raise the Hb F levels in otherwise normal individuals. Under conditions of haemopoietic stress, for example in homozygous β-thalassaemia and sickle cell disease, presence of the Xmn1-Gγ site favours a higher Hb F response. The presence of the XmnI T/T genotype correlates strongly in response to hydroxyurea treatment in transfusion-dependent β-thal patients. SNP associated with F-cell variation in healthy Northern Europeans (TwinsUK cohort; n=269 and n=775 in two independent studies). It associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1518 and n=1275 in two independent studies) and a Brazilian sickle cell disease (SCD) study sample (n=167). It associated with HbF levels and F-cell numbers in a Hong Kong Chinese sample heterozygous for the β-thalassemia mutation (n=241). It associated with HbF levels and disease severity in a study sample of Thai patients with HbE/β0-thalassemia, who were classified as clinically mild (n=207) or severe (n=305) for the disease. It associated with HbF levels in Portuguese β-thal carriers. It had a modifying effect on HbF and clinical score in Indonesian HbE/β-thal patients. The XmnI T allele associated with elevated HbF in Thai individuals with homozygous HbE (n=115), as well as with high Gγ expression in patients with SCD (Georgia, Turkey, Surinam and Saudi Arabia) and β-thalassemia (Georgia, Algeria and Sicily). The association with HbF was not replicated in SCD patients from Cameroon (n=596) and Tanzania (n=222) [PMID: 33073380]. SNP associated with significantly more pain events in young patients with SCA (BABY HUG cohort) [PMID: 23606168]. SNP associated with good response to HU treatment in terms of Hb levels and blood transfusion dependency both in β-thalassaemia and sickle cell disease cohorts [PMID: 17880608, 14722738, 15477200, 25263325]. Associated with HbF levels and gamma chains ratio (Gγ:Αγ) in an Angolan pediatric population with sickle cell anaemia [PMID: 34069401]. Associated with a robust effect on HbF levels (mean = 16.7±2.1%) in Kuwaiti patients with SCD [PMID: 34204365]. Reported to lead to 2-4% of HbF in heterozygous carriers. Disruption of the -158 binding site via CRISPR-Cas9 induced HbF expression in adult HUDEP-2 erythroid cells [PMID: 32917636]. It identifies the polymorphic site XmnI in the beta-globin gene cluster, which is used in the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Lanson Y, Reignoux J, Jobard P, Vandooren M, Rouleau P, Soret JY, [Osteogenic sarcoma of the kidney. Apropos of a case. Review of the literature]., J Urol Nephrol (Paris) , 84(10), 827-34, 1978
2. Labie D, Pagnier J, Lapoumeroulie C, Rouabhi F, Dunda-Belkhodja O, Chardin P, Beldjord C, Wajcman H, Fabry ME, Nagel RL, Common haplotype dependency of high G gamma-globin gene expression and high Hb F levels in beta-thalassemia and sickle cell anemia patients., Proc. Natl. Acad. Sci. U.S.A. , 82(7), 2111-4, 1985
3. Gilman JG, Huisman TH, DNA sequence variation associated with elevated fetal G gamma globin production., Blood , 66(4), 783-7, 1985
4. Labie D, Dunda-Belkhodja O, Rouabhi F, Pagnier J, Ragusa A, Nagel RL, The -158 site 5' to the G gamma gene and G gamma expression., Blood , 66(6), 1463-5, 1985
5. Sampietro M, Thein SL, Contreras M, Pazmany L, Variation of HbF and F-cell number with the G-gamma Xmn I (C-T) polymorphism in normal individuals., Blood , 79(3), 832-3, 1992
6. Garner C, Tatu T, Reittie JE, Littlewood T, Darley J, Cervino S, Farrall M, Kelly P, Spector TD, Thein SL, Genetic influences on F cells and other hematologic variables: a twin heritability study., Blood , 95(1), 342-6, 2000
7. Yavarian M, Karimi M, Bakker E, Harteveld CL, Giordano PC, Response to hydroxyurea treatment in Iranian transfusion-dependent beta-thalassemia patients., Haematologica, 89(10), 1172-8, 2004
8. Thein SL, Genetic insights into the clinical diversity of beta thalassaemia., Br. J. Haematol. , 124(3), 264-74, 2004
9. Alebouyeh M, Moussavi F, Haddad-Deylami H, Vossough P, Hydroxyurea in the treatment of major beta-thalassemia and importance of genetic screening., Ann. Hematol. , 83(7), 430-3, 2004
10. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007
11. Bradai M, Pissard S, Abad MT, Dechartres A, Ribeil JA, Landais P, de Montalembert M, Decreased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major or intermedia., Transfusion , 47(10), 1830-6, 2007
12. Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer LA, Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia., Clin. Genet. , 72(6), 497-505, 2007
13. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008
14. Koren A, Levin C, Dgany O, Kransnov T, Elhasid R, Zalman L, Palmor H, Tamary H, Response to hydroxyurea therapy in beta-thalassemia., Am. J. Hematol. , 83(5), 366-70, 2008
15. Gibney GT, Panhuysen CI, So JC, Ma ES, Ha SY, Li CK, Lee AC, Li CK, Yuen HL, Lau YL, Johnson DM, Farrell JJ, Bisbee AB, Farrer LA, Steinberg MH, Chan LC, Chui DH, Variation and heritability of Hb F and F-cells among beta-thalassemia heterozygotes in Hong Kong., Am. J. Hematol. , 83(6), 458-64, 2008
16. Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008
17. Italia KY, Jijina FJ, Merchant R, Panjwani S, Nadkarni AH, Sawant PM, Nair SB, Ghosh K, Colah RB, Response to hydroxyurea in beta thalassemia major and intermedia: experience in western India., Clin. Chim. Acta , 407(1), 10-5, 2009
18. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010
19. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
20. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011
21. Banan M, Bayat H, Azarkeivan A, Mohammadparast S, Kamali K, Farashi S, Bayat N, Khani MH, Neishabury M, Najmabadi H, The XmnI and BCL11A single nucleotide polymorphisms may help predict hydroxyurea response in Iranian β-thalassemia patients., Hemoglobin , 36(4), 371-80, 2012
22. Akinsheye I, Solovieff N, Ngo D, Malek A, Sebastiani P, Steinberg MH, Chui DH, Fetal hemoglobin in sickle cell anemia: molecular characterization of the unusually high fetal hemoglobin phenotype in African Americans., Am J Hematol, 87(2), 217-9, 2012
23. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013
24. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013
25. Pakdee N, Yamsri S, Fucharoen G, Sanchaisuriya K, Pissard S, Fucharoen S, Variability of hemoglobin F expression in hemoglobin EE disease: hematological and molecular analysis., Blood Cells Mol. Dis. , 53(1), 11-5, 2014
26. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014
27. Cardoso GL, Diniz IG, Silva AN, Cunha DA, Silva Junior JS, Uchôa CT, Santos SE, Trindade SM, Cardoso Mdo S, Guerreiro JF, DNA polymorphisms at BCL11A, HBS1L-MYB and Xmn1-HBG2 site loci associated with fetal hemoglobin levels in sickle cell anemia patients from Northern Brazil., Blood Cells Mol. Dis. , 53(4), 176-9, 2014
28. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015
29. Mtatiro SN, Makani J, Mmbando B, Thein SL, Menzel S, Cox SE, Genetic variants at HbF-modifier loci moderate anemia and leukocytosis in sickle cell disease in Tanzania., Am. J. Hematol., 90(1), E1-4, 2015
30. Vathipadiekal V, Alsultan A, Baltrusaitis K, Farrell JJ, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Suliman A, Patra PK, Milton JN, Farrer LA, Chui DH, Al-Ali AK, Sebastiani P, Steinberg MH, Homozygosity for a haplotype in the HBG2-OR51B4 region is exclusive to Arab-Indian haplotype sickle cell anemia., Am. J. Hematol. , 91(6), E308-11, 2016
31. Rujito L, Basalamah M, Siswandari W, Setyono J, Wulandari G, Mulatsih S, Sofro AS, Sadewa AH, Sutaryo S, Modifying effect of XmnI, BCL11A, and HBS1L-MYB on clinical appearances: A study on β-thalassemia and hemoglobin E/β-thalassemia patients in Indonesia., Hematol Oncol Stem Cell Ther , 9(2), 55-63, 2016
32. Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017
33. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020
34. Delgadinho M, Ginete C, Santos B, Miranda A, Brito M, Genotypic Diversity among Angolan Children with Sickle Cell Anemia., Int J Environ Res Public Health, 18(10), 0, 2021
35. Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021