IthaID: 2120
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -495 (A>T) | HGVS Name: | NG_023030.1:g.4613A>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGTTCCTGATGTTGCCCACCAGGCT [A/T] TTGCTCTGAGCAGCGCTGCCTCCCA (Strand: +)
Comments: HMOX1-413 A>T associated with less frequent vaso-occlusive crisis (VOC)/lifetime, less VOC in the last year, less incidence of stroke, less frequency of hospitalization, and responded more frequently to hydroxyurea with statistically significant differences among Egyptian sickle cell disease (SCD) patients. Also, the T allele associated with higher levels of HbF in SCD patients from Brazil, Iran and India, but not in an Egyptian SCD cohort.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Stroke [HP:0001297] [OMIM:601367] Vaso-occlusive crisis |
Location
| Chromosome: | 22 |
|---|---|
| Locus: | NG_023030.1 |
| Locus Location: | 4613 |
| Size: | 1 bp |
| Located at: | HMOX1 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Brazilian, Iranian, Egyptian, Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Gil GP, Ananina G, Oliveira MB, Costa FF, Silva MJ, Santos MN, Bezerra MA, Hatzlhofer BL, Araujo AS, Melo MB, Polymorphism in the HMOX1 gene is associated with high levels of fetal hemoglobin in Brazilian patients with sickle cell anemia., Hemoglobin , 37(4), 315-24, 2013
- Bakr S, Khorshied M, Talha N, Jaffer KY, Soliman N, Eid K, El-Ghamrawy M, Implication of HMOX1 and CCR5 genotypes on clinical phenotype of Egyptian patients with sickle cell anemia., Ann. Hematol., 2019
- Hariharan P, Chavan V, Nadkarni A, Significance of heme oxygenase-1(HMOX1) gene on fetal hemoglobin induction in sickle cell anemia patients., Sci Rep, 10(1), 18506, 2020
Created on 2013-09-19 13:19:31,
Last reviewed on 2020-11-12 08:48:01 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.