IthaID: 2117


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs6037828 HGVS Name: NG_011970.1:g.40474G>A

Context nucleotide sequence:
CCTGAGGTATACACATACAGAGTCA [C/T] GGAGGTTTTCTGACAAAAACTACTC (Strand: +)

Also known as:

Comments: SNP strongly associated with increased HbF levels in the general (non-anaemic) population of Sardinia (n=4305) [PMID: 18245381]. The association was not replicated in a β-thalassemia Chinese cohort (n=312) [PMID: 22023465].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 20
Locus: NG_011970.1
Locus Location: 40474
Size: 1 bp
Located at: CSNK2A1
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese, Sardinians
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008
  2. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011
Created on 2013-09-18 17:12:18, Last reviewed on 2016-05-16 16:48:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.