IthaID: 2113


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs6530488 HGVS Name: NG_016419.1:g.49197C>T

Context nucleotide sequence:
TTGTTTAATAAGCTCTGCTCAAAAG [C/T] TGACTTTTTTTTCAGATTATGGGTC (Strand: +)

Also known as:

Comments: SNP exhibited modest association with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=848).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for Aγ or Gγ
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: X
Locus: NG_016419.1
Locus Location: 49197
Size: 1 bp
Located at: FRMPD4
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Solovieff N, Milton JN, Hartley SW, Sherva R, Sebastiani P, Dworkis DA, Klings ES, Farrer LA, Garrett ME, Ashley-Koch A, Telen MJ, Fucharoen S, Ha SY, Li CK, Chui DH, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5' olfactory receptor gene cluster., Blood , 115(9), 1815-22, 2010
Created on 2013-09-18 11:33:52, Last reviewed on 2016-05-23 16:22:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.