IthaID: 211

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-654 C>T HGVS Name: HBB:c.316-197C>T
Hb Name: N/A Protein Info: β nt 1149 C>T
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AACAGTGATAATTTCTGGGTTAAGG [C/T] AATAGCAATATCTCTGCATATAAAT (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0 / β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71693
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Cryptic splice site (mRNA Processing)
Ethnic Origin: Chinese, SE Asian, Japanese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Cheng TC, Orkin SH, Antonarakis SE, Potter MJ, Sexton JP, Markham AF, Giardina PJ, Li A, Kazazian HH, beta-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects., Proceedings of the National Academy of Sciences of the United States of America, 81(9), 2821-5, 1984
  2. Takihara Y, Matsunaga E, Nakamura T, Lin S, Lee H, Fukumaki Y, Takagi Y, One base substitution in IVS-2 causes a beta +-thalassemia phenotype in a Chinese patient., Biochemical and biophysical research communications, 121(1), 324-30, 1984
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-24 16:08:23 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.