IthaID: 2109
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs9402685 | HGVS Name: | NC_000006.12:g.135098550T>C |
Context nucleotide sequence:
ACGATGTTTCACCGTGTTGCTCAGG [C/T] TGCTCTCGAACTCCTGAGCTCAGGC (Strand: +)
Also known as:
Comments: SNP associated with F-cell numbers in healthy Northern Europeans (TwinUK cohort). It strongly associated with HbF level variation in individuals from China with β-thalassaemia (n=312).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NT_025741.15 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | HBS1L-MYB |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | North European, Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Thein SL, Menzel S, Peng X, Best S, Jiang J, Close J, Silver N, Gerovasilli A, Ping C, Yamaguchi M, Wahlberg K, Ulug P, Spector TD, Garner C, Matsuda F, Farrall M, Lathrop M, Intergenic variants of HBS1L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults., Proc. Natl. Acad. Sci. U.S.A. , 104(27), 11346-51, 2007
- He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011
Created on 2013-09-17 12:30:00,
Last reviewed on 2018-11-20 17:51:54 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.