IthaID: 2106

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4895440 HGVS Name: NC_000006.12:g.135105420A>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTTTAGAAAGCGTGGCTGGGGAAAG [A/T] CTCTTTGTAAAGTGATACATGAGCA (Strand: +)

Comments: SNP associated with HbF/F-cell variation in healthy Northern Europeans (TwinUK cohort). It associated with HbF level variation in individuals from China with β-thalassaemia (n=312).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: North European, Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Thein SL, Menzel S, Peng X, Best S, Jiang J, Close J, Silver N, Gerovasilli A, Ping C, Yamaguchi M, Wahlberg K, Ulug P, Spector TD, Garner C, Matsuda F, Farrall M, Lathrop M, Intergenic variants of HBS1L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults., Proc. Natl. Acad. Sci. U.S.A. , 104(27), 11346-51, 2007
  2. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011
Created on 2013-09-16 15:48:12, Last reviewed on 2018-11-20 17:48:44 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.