IthaID: 2104


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs35959442 HGVS Name: NC_000006.12:g.135103041C>G

Context nucleotide sequence:
GGCCCCCCCTCATCACTTCCTGAAG [C/G] CTGCTGTAGACTGCTATAAGAGCGG (Strand: +)

Also known as:

Comments: C>G variation associated with HbF levels under an additive model in individuals from China with β-thalassemia [PMID: 22023465]. The G allele associated with HbF in the high-HbF (>30%) subgroup of Kuwaiti patients with sickle cell disease [PMID: 34204365].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese, Kuwaiti
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011
  2. Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021
Created on 2013-09-16 15:06:02, Last reviewed on 2021-09-23 17:15:52 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.