IthaID: 2103


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs6904897 HGVS Name: NC_000006.12:g.135061842T>G

Context nucleotide sequence:
CAGGCTTGCCAAATATACCTTGTTA [G/T] TGTATGCACAACcaaaagaaataca (Strand: +)

Also known as:

Comments: SNP associated with variation in F-cell numbers in healthy Northern Europeans (TwinUK cohort). It exhibited strong effect on the severity of β-thalassaemia phenotype in Sardinian subjects.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: F-cell numbers

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Sardinian, Northern European
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007
  2. Danjou F, Anni F, Perseu L, Satta S, Dessì C, Lai ME, Fortina P, Devoto M, Galanello R, Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion., Haematologica , 97(7), 989-93, 2012
Created on 2013-09-13 14:34:30, Last reviewed on 2018-11-20 17:42:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.